Sign up to receive the sTaRe newsletter!
HOME | ARCHIVES | MAKE US YOUR STARTPAGE | RSS | SUGGESTIONS | TEAM
sTaRe: Guest Sidebar
Archives | RSS for sidebar

Saturday, January 31, 2004
screed byvalis
Randy Glass warned complicit Bob Graham of ISI/9-11 connection

{via Awoken}

1:19 AM : Permalink

• • •

FWA
Your Freewill Astrology for this Week
Aries Libra
Taurus Scorpio
Gemini Sagittarius
Cancer Capricorn
Leo Aquarius
Virgo Pisces

Archived Literature
Teenage Trash
I HATE YOU ALL!
ozric dampierre
on...
PrisonPlanet
Manifesto in Hypertext
The Rat

sTaRe Network

Disinfo

Listed on BlogShares

syndic8

No RIAA!

Technorati Profile

sCrAwLz foR Saturday, March 15, 2003
A difficult gift
As The Three Stigmata Of Palmer Eldritch is reissued, Michael Moorcock finds he has some problems with Philip K Dick

Dick's speed-enhanced gift was to capture the illusion sometimes encountered by the deadline-conscious hack, hyped on adrenaline, playing with transcen- dental notions that creator and creations, illusions and reality are one. As with hallucinogens, the condition can cause obsession and psychosis, a distinct sense that the book is writing you. You become merely a medium. Common sense usually brings you back to shared reality. But in the case of Dick or L Ron Hubbard, inventor of Scientology, the experience formed the basis of a rough and ready belief system resembling Buddhism or Manichaeism. Does the mind control reality? Do good and evil emanate from the same source? What do we worship and why?

As he followed these themes, Dick's novels became increasingly incoherent and, for me, scarcely readable. Hacking out book after book, he gave himself no time to discover a more idiosyncratic structure or style, the search for which characterised the so-called SF New Wave and gave us sophisticated American visionaries such as Thomas M Disch, John Sladek and Samuel R Delany. FULL STORY>> | Via BB
scrawled on the wall by TheLoneDeRanger : 3/15/2003 06:04:48 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


The Puma "French Pleasure" Campaign: Hoax
It has been brought to our attention that several unauthorized, sexually suggestive advertisements portraying the PUMA brand have been released over the Internet. We are appalled that images like these would be created and distributed under the PUMA name. As a brand, we seek to take a unique perspective toward our advertising in an effort to challenge the boundaries of our industry; however we would never consider using these tactics. We are in the process of researching the circumstances and reserve any legal steps available.
scrawled on the wall by TheLoneDeRanger : 3/15/2003 03:04:45 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Scientists Say Other Universes Physically Real and Inhabited
Some of you have asked if we knew where to find this article. Here it is. Other good links on the bottom of this article too.

Scientist now say we are definitely not alone, that our universe contains an infinite number of other universes, much like our own, called O-regions, and that we may someday be able to contact them.
Jaume Garriga, of the University of Barcelona and Alexander Vilenkin, of Tufts University, say that their “many worlds in one” concept means that these other worlds are likely to be similar to our own, with similar life forms. They will publish their hypothesis this fall in the journal Gravitation and Quantum Cosmology. MORE>>
scrawled on the wall by TheLoneDeRanger : 3/15/2003 02:37:52 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Hi, I'm Casey Kasem and this is P2P Top 40
Peer-to-peer networks may soon play a prominent role in shaping radio playlists. Clear Channel Communications plans to add data about the popularity of songs on P2P networks to the research services it offers to radio stations. The data, provided by P2P tracking outfit BigChampagne, will provide radio stations with lists of P2P users with MP3 collections similar to their playlists and information about what those people are downloading and offering to other users on the networks.
scrawled on the wall by TheLoneDeRanger : 3/15/2003 12:37:53 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •

sCrAwLz foR Friday, March 14, 2003
46th issue of Ten Thousand Monkeys
Welcome to the 46th issue of Ten Thousand Monkeys. I'm just gonna cut straight to the chase here, if you don't mind ... This issue is kinda old home week here at M10K. We have some lyrics from our M10K veteran Quintus, and two long lost monkeys are back with some fantabulous stories for your perusal. We also continue our recurring series The Raven, Wounded, and Monterrey Moon, AND a brand new monkey joins the mix with some remixing of his own.
scrawled on the wall by TheLoneDeRanger : 3/14/2003 11:22:26 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Raging Back at the Cow
Dr Pepper/Seven Up cowed by Web plan

Dr Pepper/Seven Up was hoping a novel Internet campaign would generate buzz about its new flavoured milk drink, Raging Cow.

Instead, consumers are raging about the company's marketing tactics, labelling the effort "shady" and "immoral." Some are calling for a boycott of the product, just as it is being rolled out to U.S. stores.

How did Dr Pepper/Seven Up's launch go off course? The story of Raging Cow — a product the company hopes to bring to Canada in the next few years — illustrates the risks marketers face when they try to spark positive chatter on the Internet, a borderless medium with its own rules and culture that can't be controlled the way traditional ads on TV or in magazines can. MORE>>
scrawled on the wall by TheLoneDeRanger : 3/14/2003 10:28:47 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


US Announces New Ally: Harvey

US Announces New Ally: Harvey


March 13, 2003 - THE WHITE HOUSE - Today Colin Powell announced a powerful new US ally in the war on Iraq: Harvey. "He's big, he's mean, and he's invisible." Colin Powell told reporters. "This kind of ally can do significant damage over there."

Colin Powell then told the reporters that they could ask Harvey questions, but since Powell was the only one who could hear Harvey, he would have to translate Harvey's responses.

Helen Thomas raised her hand and was immediately escorted to the hallway ("for her own protection"). Colin Powell, after consulting his list, called on Jerry Braun from the AP. Jerry asked, "Harvey, which do you prefer, french fries or freedom fries?"

The room laughs. Colin laughs, too, then nods as he listens to Harvey's response before saying, "Freedom fries, of course. With lots of ketchup."

The White House press corp laughs harder. Some wipe tears from their eyes.

Colin looks at the list again and then calls on Mary Watanabe from the Duluth Herald. "Harvey, as we all know, Saddam Hussein is hoarding enough weapons of mass destruction to turn our beautiful big earth into nothing but a radioactive desert for millenia to come. So, even though you are aided by the heroic beyond-all-ability-to-describe US military, aren't you at all concerned for your safety?"

Colin bows his head slightly while he listens, this time his brow furrowing. "Yes, great question. Well, I love this country, enough to die for it. And I love the innocent civilians of Iraq, as well. That's why I'm willing to die to liberate them as well from the murderous dictator known as Saddam Hussein. So, there you go."

Colin raises his head and calls on another reporter from his list.

Joe Coleman from CNN asks: "Harvey, since you're invisible, will you be sent on a mission which can best utilize this ability? Namely, the assassination of Saddam Hussein? And I have a followup question."

Colin listens for a minute and then responds, "I can't talk at all about my missions right now, Joe. Let's just say that whatever I do, I do it for freedom, I do it for America, and I do it for God." Colin pauses and then asks for the followup question.

Joe: "If you're back by Easter could you come over to my house for my little daughter's Easter party? Perhaps we could paint your fur so that you could be seen--you'd make so many kids very happy."

Colin listens then, "I'd love to, Joe. Right after the Hero's Welcome Parade. The only thing I look forward to more than seeing newly liberated Iraqis jumping up and down in the street for joy because now they are free to develop their own democracy--after envying ours for so many years--is coming home to a Hero's Welcome here in America. Especially the parade in New York city to welcome us back with love, cheers and thousands of patriotic streamers!"

Colin then calls on Mimi Applegate from USA TODAY. Mimi: "Harvey, I don't have a question but a comment: WE LOVE YOU HARVEY!!!" The room cheers. [Coincidentally, this became the headline on the next day's issue of USA TODAY.] Russell Mokhiber raises his hand to ask a question and is immediately escorted out into the hallway ("for his own protection").

Colin thanks everyone for coming and relays to them Harvey's last words: "God Bless you, and God Bless America!" before closing the press conference by leading the White House press corp in a rousing recitation of the Pledge of Allegiance. Many wipe tears from their eyes. The end.

scrawled on the wall by Dr. : 3/14/2003 02:30:28 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


The people who control the world
Jon Ronson goes looking for 'Them'

Every generation gets its world-controlling cabal.

The Middle Ages had the Knights Templar. The 18th century had the Masons and the Illuminati. Our modern age has golf-playing businessmen and 12-foot lizard-men. Or so Jon Ronson was led to believe. Ronson, a 35-year-old British writer, humorist and documentarian, kept reading and hearing about the "tiny elite [that] rules the world from inside a secret room" -- so he decided to go in search of it. MORE>>
scrawled on the wall by TheLoneDeRanger : 3/14/2003 01:57:21 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Parents should be aware of ads posing as games
No parent would voluntarily subject a child to 15 minutes of non-stop commercial messages touting candy, junk food or sugar-sweetened cereal.

But a new form of advertising does just that -- and manages to fly under the parental radar. It's called "advergaming.'' And it's a new marketing approach that uses free online games to promote a product -- say, Mesquite Barbecue Pringles or LifeSaver candies -- or build awareness for a particular brand, such as Levi Strauss.

This advertising comes without any disclosure to alert kids that they're being subjected to an ever-so-subtly-crafted ad pitch. And even Nickelodeon, which carefully labels banner ads and pop-ups for what they are -- advertising -- forces kids to download software to display these ad messages disguised as games. MORE>>
scrawled on the wall by TheLoneDeRanger : 3/14/2003 12:27:39 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •

sCrAwLz foR Thursday, March 13, 2003
The myth of interference
Internet architect David Reed explains how bad science created the broadcast industry.

There's a reason our television sets so outgun us, spraying us with trillions of bits while we respond only with the laughable trickles from our remotes. To enable signals to get through intact, the government has to divide the spectrum of frequencies into bands, which it then licenses to particular broadcasters. NBC has a license and you don't. Thus, NBC gets to bathe you in "Friends," followed by a very special "Scrubs," and you get to sit passively on your couch. It's an asymmetric bargain that dominates our cultural, economic and political lives -- only the rich and famous can deliver their messages -- and it's all based on the fact that radio waves in their untamed habitat interfere with one another. Except they don't. MORE>>
scrawled on the wall by TheLoneDeRanger : 3/13/2003 04:48:25 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Spooky Story
Why the American media shrugged off a story about spying at the United Nations

On Saturday evening March 1, Daniel Ellsberg was noodling around the Web and happened across a story from the British newspaper The Observer that caught his eye under the tantalizing headline, "Revealed: US Dirty Tricks to Win Vote on Iraq War." The paper's Martin Bright, Ed Vulliamy and Peter Beaumont had obtained a copy of a memo from a National Security Agency (NSA) official outlining U.S. plans to spy on certain United Nations Security Council members to get some insight into their thinking on Iraq and the coming Security Council vote.

Interesting, Ellsberg thought. "So I rushed out the next morning at 5 o'clock to get [The New York Times] to see how they were covering it," he told me. Naturally, he was disappointed. And remains so, because, as I write, the Times has yet to mention the story, which has received only scant coverage elsewhere in the American press.

Meanwhile, it's received far more coverage around the globe. And at the end of last week, the story took an ominous new turn. A British employee of the Government Communications Headquarters (Britain's NSA), a 28-year-old woman, was arrested on suspicion of leaking the memo. The Observer reports now that Tony Blair's government -- with his political future conceivably hanging on what happens at the United Nations in the coming days -- has commenced a search for more leakers and is seeking more arrests. Hence Ellsberg's interest.

"A Pentagon Papers case, essentially, is happening right now in Britain," he says, "around a memo whose revelation could dramatically affect the Security Council's vote. And by and large, Americans don't even know about it." >>
scrawled on the wall by TheLoneDeRanger : 3/13/2003 04:30:44 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


World's first brain prosthesis revealed
The world's first brain prosthesis - an artificial hippocampus - is about to be tested in California. Unlike devices like cochlear implants, which merely stimulate brain activity, this silicon chip implant will perform the same processes as the damaged part of the brain it is replacing.
scrawled on the wall by TheLoneDeRanger : 3/13/2003 04:28:22 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


PENTAGON THREATENS TO KILL INDEPENDENT REPORTERS IN IRAQ
The Pentagon has threatened to fire on the satellite uplink positions of independent journalists in Iraq, according to veteran BBC war correspondent, Kate Adie. In an interview with Irish radio, Ms. Adie said that questioned about the consequences of such potentially fatal actions, a senior Pentagon officer had said: "Who cares.. ..They've been warned."

According to Ms. Adie, who twelve years ago covered the last Gulf War, the Pentagon attitude is: "entirely hostile to the the free spread of information." MORE>>
scrawled on the wall by TheLoneDeRanger : 3/13/2003 04:27:45 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Chinese court date set for Bay Area man
GOVERNMENT ACCUSES FALUN GONG FOLLOWER OF DISRUPTING RADIO, TELEVISION BROADCASTS

A Chinese court said Tuesday it would put an American citizen on trial later this month on charges of disrupting government television and radio broadcasts -- accusations apparently related to his ties to the banned Falun Gong spiritual movement. Charles Li of Menlo Park will be tried March 21 for "sabotaging state broadcasting equipment," said an official of the Yangzhou Intermediary Court in the eastern province of Jiangsu. U.S.-based Falun Gong organizers have identified him as a follower of their group. The court official, who gave only her surname, Jiang, provided no other information about the charges or trial. However, the charges appeared to be related to the hijacking of Chinese cable and satellite television broadcasts by Falun Gong followers to show videos protesting the Chinese government ban on their group. >>
scrawled on the wall by TheLoneDeRanger : 3/13/2003 04:27:44 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Company to Provide Physics-Based Network Management -- Secures Additional Funding and New Executives
Mountain View's Network Physics, a start-up that says it is the first to apply particle physics to network management, announced that it has raised $6 million in funding. The round was led by Sofinnova Venture Partners, and included Vantage Point Venture Partners, Intel Capital, Lucent Venture Partners, InfoVista and AIG
scrawled on the wall by TheLoneDeRanger : 3/13/2003 04:26:39 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


German tech fair low-key
Thinner and subdued, the world's biggest technology fair reflected the industry mood Tuesday as mobile phone operators unveiled plans to phase in next-generation service and other new gadgets focused on combining or improving existing technology.

With fears of an Iraq war and weak consumer demand weighing on the CeBIT fair, the number of exhibitors was down 20 percent to about 6,500. Many of those attending are emphasizing software and equipment that can save companies money, rather than pushing the next cool thing. >>
scrawled on the wall by TheLoneDeRanger : 3/13/2003 04:26:12 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Anger management attendee arrested for assault in Fremont
So much for controlling his temper. A Fremont man has been arrested for allegedly assaulting a 37-year-old acquaintance whom he had recently met at an anger management seminar.David Glen Wilson, 36, had hired the 37-year-old man to install marble at his home on the 5500 block of Truman Place, police said. They began working on the project at 9 p.m. Sunday and continued through the next morning.

At about 9 a.m. Monday, Wilson discovered his pit bull puppy was missing, so he and his girlfriend and the acquaintance went looking for it. Later, Wilson found his pet chicken dismembered in the backyard and assumed his new acquaintance had killed the animal, according to Fremont police spokesman Bill Veteran. Police said Wilson had another full grown dog tethered outside, which was in reach of the chicken.

Police do not know who actually killed the chicken, but said Wilson attacked the victim, slashing him with a knife above the eye, choking him and wrestling him to the ground before the victim broke free. Wilson allegedly then smashed all the windows on the victim's van with a two by-four and slashed the tires. The victim, meanwhile, fled to a neighbor's house and police were called. The victim was treated and released from Washington Hospital in Fremont. Wilson was arrested on suspicion of vandalism and assault with a deadly weapon.
scrawled on the wall by TheLoneDeRanger : 3/13/2003 04:25:24 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Iraqi "Smoking gun" made with duct tape
A remotely piloted aircraft that the United States has warned could spread chemical weapons appears to be made of balsa wood and duct tape, with two small propellors [sic] attached to what look like the engines of a weed whacker.

In Washington's search for a "smoking gun" that would prove Iraq is not disarming, Powell has insisted the drone, which has a wingspan of 24.5 feet, could be fitted to dispense chemical and biological weapons. He has said it "should be of concern to everybody." - chiaroscuro
scrawled on the wall by TheLoneDeRanger : 3/13/2003 02:57:04 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •

sCrAwLz foR Wednesday, March 12, 2003
PAYPAL CLOSES WHAT REALLY HAPPENED ACCOUNT!
Just received from PayPal...
As you know, the PayPal User Agreement states that PayPal, at its sole discretion, reserves the right to close an account at any time for any reason. We write to inform you that, after a review of your site, and in accordance with the User Agreement, your account has been closed. Your funds will be held for 180 days from the date of the last transaction on the account. After 180 days have expired, we will refund your funds by mailing a check to the address linked to your account.
Sincerely,
Merchant Risk Department


Now, as an experiment, type the words "PayPal" and "Porno" into any search engine. I used Google and got a list of hundreds of pornography web sites that PayPal does not seem to have any qualms about doing business with!

Note also that PayPal is going to hold onto the funds YOU have already donated for almost 6 months before turning them over to us. | Via Vampagan.
scrawled on the wall by TheLoneDeRanger : 3/12/2003 04:32:11 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Vocabulary Lesson of the Day: Catafalque
Sure you know that rigor mortis is "rigidity of the muscles which occurs at death," but did you know that algor mortis is "the cooling of the body immediately after death to room temperature and temporary stiffening of the muscles"? You know your morgue from your columbarium, but can you tell your cenotaph from your catafalque? Get it all straight at Funeral Net. (And yes, there is already a Goth band called Catafalque. You can't have the name. Alas.)
scrawled on the wall by magdalen : 3/12/2003 09:49:29 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Official "Extraterrestrial Culture Day" in New Mexico
A New Mexico legislator proposed on Monday having the state honor all extraterrestrial beings with a special day that will "celebrate and honor all past, present and future extraterrestrial visitors" to New Mexico, the measure reads.

Rep. Dan Foley, a Republican from Roswell, said he introduced the legislation to "enhance relationships among all the citizens of the cosmos, known and unknown."

Extraterrestrial Culture Day would be held the second Thursday of February.
scrawled on the wall by S. : 3/12/2003 05:39:03 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Benetton clothing to carry tiny tracking transmitters
Clothes sold at Benetton stores will soon contain microchip transmitters that allow the Italian retailer to track its garments from their point of manufacture to the moment they're sold in any of its 5,000 shops. Benetton's introduction of "smart tag'' tracking technology will be the largest example of a trend now emerging in the retail industry, according to Phillips Semiconductors, a unit of the Dutch electronics giant that designed 15 million tags being delivered to Benetton this year. Benetton's Sisley line of clothing will contain a Philips Electronics radio frequency ID tag that will replace ubiquitous bar codes, which have to be manually scanned. An RFID tag communicates its location to Benetton's computerized supply chain network, allowing the retailer to learn the status of its inventory at a glance and make restocking decisions quickly -- even automatically, said Terry Phipps, Benetton's electronic data processing director. While there is no indication Benetton intends to track its customers with the tags, privacy advocates are worried that the technology could lend itself to unauthorized customer monitoring. >>
scrawled on the wall by TheLoneDeRanger : 3/12/2003 04:25:41 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


House cafeterias change names for 'french fries' and 'french toast' (and you can dance to it...)
It's official. Our leaders are idiots...but the real question is...are they WiFries? Does it have a beat? Can I dance to it?
As always with fast food, it's just not fast enough for some people...hurry up and wait.
Did someone say "Echelon"? No? Quick, say "I obey!" three times really fast and genuflect. I've heard that can cancel it out. Aww, crap. All this dancin', yackin' and salty WiFries has made me thirsty. Maybe a doughnut would go good with that. You'll stop staring now if you know what's good for you.
scrawled on the wall by TheLoneDeRanger : 3/12/2003 12:24:23 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •

sCrAwLz foR Tuesday, March 11, 2003
Software Pioneer Quits Board of Groove
Mitchell D. Kapor, a personal computer industry software pioneer and a civil liberties activist, has resigned from the board of Groove Networks after learning that the company's software was being used by the Pentagon as part of its development of a domestic surveillance system.

Mr. Kapor would say publicly only that it was a "delicate subject" and that he had resigned to pursue his interests in open source software.

The company acknowledged the resignation last week when it announced that it had received $38 million in additional financing.

"Mr. Kapor resigned from the board to focus 100 percent of his time on nonprofit activities," said a spokesman for Groove Networks, whose software has been used to permit intelligence analysts and law enforcement officials to share data in tests of the surveillance system, Total Information Awareness.

However, a person close to Mr. Kapor said that he was uncomfortable with the fact that Groove Networks' desktop collaboration software was a crucial component of the antiterrorist surveillance software being tested at the Defense Advanced Research Project Agency's Information Awareness Office, an office directed by Vice Adm. John M. Poindexter. >>
scrawled on the wall by TheLoneDeRanger : 3/11/2003 11:38:18 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Three and a half-year old SETI@home project identifies candidate radio signals from space, heads for Arecibo to take second look
After more than a million years of computation by more than 4 million computers worldwide, the SETI@home screensaver that crunches data in search of intelligent signals from space has produced a list of candidate radio sources that deserve a second look.

Three members of the SETI@home team will head to Puerto Rico this month to point the Arecibo radio telescope at up to 150 spots identified as the source of possible signals from intelligent civilizations. >>
scrawled on the wall by TheLoneDeRanger : 3/11/2003 08:37:22 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Think tanks for gamers
Online communities that band together to solve puzzles could provide clues to the next big step in social development.
It is not just many hands that make light work. Many minds do too.
New forms of collaboration on the net are giving rise to clever crowds able to solve challenges and puzzles that most individuals would struggle to tackle alone.

These novel forms of problem-solving are emerging because the net makes it easy for people to keep in constant touch, to bring together experts on wildly different subjects, and to access much of the world's knowledge. >>

Also see: It's Just a Fantasy, but Real Life Is Always in Play (NYT)
scrawled on the wall by TheLoneDeRanger : 3/11/2003 04:05:59 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Article on Rupert Sheldrake speech
In a new book being published Tuesday, "The Sense of Being Stared At," Sheldrake says 90 percent of people have reported having this sensation. The experience is not a quirk of our brains, he writes, "but leads to the conclusion that our minds are not confined inside our heads."

To test the hypothesis, Sheldrake blindfolded subjects and had a "starer" alternately look or turn away from them. The subjects then recorded whether they believed they were being looked at or not. By the laws of chance, 50 percent of guesses would be correct. But Sheldrake said results showed consistently that people end up getting it right 55 percent of the time. | Via NWD
scrawled on the wall by TheLoneDeRanger : 3/11/2003 04:04:58 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Antiquities of the Illuminati Version 4,4, 11 March 2003 c.e.
For whatever it's worth, Version 4.4 is posted. Big fucking sister aside, we have managed to get some material finished. That's an inside joke, for the Initiated, of course.
Please START WITH: http://www.antiqillum.com/index.htm and then go from there. We have new materials, but we want everybody to start from the beginning because we have reorganized the entire file system since we got our space on the New Server.
http://www.antiqillum.com/main/welcome.htm, http://www.antiqillum.com/main/new.htm, http://www.antiqillum.com/main/texts.htm Of course we can't forget: http://www.antiqillum.com/texts/2_bs/2_BS.htm , http://www.antiqillum.com/texts/generaled/generaled.htm

The Bishop de Sade.
Networking the HIGHER Learning© - And don't you forget it!
scrawled on the wall by Jonathan : 3/11/2003 06:39:57 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


GCHQ arrest over Observer spying report
An employee at the top-secret Government Communications Headquarters (GCHQ) has been arrested following revelations in The Observer last weekend about an American 'dirty tricks' surveillance operation to win votes at the United Nations in favour of a tough new resolution on Iraq.
Gloucestershire police confirmed last night that a 28-year-old woman was arrested last week on suspicion of contravening the Official Secrets Act. The woman, from the Cheltenham area, has been released on police bail pending further inquiries. More arrests are expected.
A top-secret memo from the National Security Agency, which monitors communications around the world, was passed to this newspaper by British security sources who objected to being asked to aid the American operation. The leak marks a serious breach between the Blair government and elements of the intelligence community opposed to using British security resources to help the US drive towards war.
Officials at GCHQ, the electronic surveillance arm of the British intelligence service, were asked by the Americans to provide valuable information from 'product lines', intelligence jargon for phone taps and e-mail interception. The document was circulated among British intelligence services before being leaked.
A GCHQ spokesman confirmed last night that the woman was an employee. | Via charging the canvas
scrawled on the wall by TheLoneDeRanger : 3/11/2003 05:00:36 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Dr. Menlo/NWD E-Zine Review From abuddhas memes
Dr. Menlo epitomises the more natural flow of discourse and diversity that is the true strength of the American people. His egalitarian and plainly literate hug embraces such webwonders as American Samizdat, New World Disorder, IncuBlogula, Warblogger Watch, Le Blogeur, thumbmonkey, Sensual Liberation Army, this humble site, and some I'm sure I've missed.

Further, the "idea" of Dr. Menlo reaches far beyond the wide-ness he hosts or contributes to, to ripple upon the shores of Mediahood herself. This is a borderland where content and context are sweet relief in a jungle of interspun confusion, where the essential rains cry mercy whilst our essential brains remember the joke; cosmic, man.

Newly added to this wonder full explication of our implicate isness are the New World Disorder Magazine, which includes the Dear Doc's invaluable essay Manifesto in Hypertext, amongst a hyperbole of other wit-full writing by polytextual geniuses. Also exciting, although I can't listen with my ancient technology (I need a modemectomy!), is dr menlo radio - revolution radio/music for the masses...yummy.
scrawled on the wall by TheLoneDeRanger : 3/11/2003 04:45:01 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Sea-level rise shelved for now
Glaciers spotted surging to sea after ice-shelf collapse.
Parts of Antarctica's icy fringes are propping up its vast glaciers, new research confirms1. Where ice shelves have collapsed due to global warming, the continent's remaining ice is surging into the sea. This could speed a feared rise in sea level. >>
scrawled on the wall by TheLoneDeRanger : 3/11/2003 03:48:46 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Green plans for tiny tech: Nanotechnologists take responsible approach to the environment.
A US research centre is working to develop tiny technology in an environmentally friendly way, its director told this week's meeting of the American Physical Society in Austin, Texas.

Rice University's Center for Biological and Environmental Nanotechnology in Houston, Texas, is trying to identify the potential impacts of manipulating matter on the scale of atoms and molecules to make devices over a thousand times thinner than a human hair. >>
scrawled on the wall by TheLoneDeRanger : 3/11/2003 03:45:19 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •

sCrAwLz foR Monday, March 10, 2003
Flashback
This impressive Flash movie-trip featuring Albert Hoffman as doc, calls for getting into a certain mindspace, taking the time and enjoying. Exceptional artwork.
scrawled on the wall by Cyndy : 3/10/2003 10:27:43 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Don't forget to feed the TACTCTTTACCTTTTATTCG
This past weekend 40 scientists determined to describe and name the estimated 10 million animal species that have not yet been catalogued met to discuss an alternative to the official Latin monikers used to classify the world's animal species: bar codes. "The proper naming of species has become a serious bottleneck," said Professor Paul Hebert, of the University of Guelph, in Canada, who attended the meeting. "I do think it is a serious problem, and I believe the move to DNA-based taxonomy will lead to a new approach to the description of species. After the bar coding, those who then want to name and describe species can come along over the next 2,000 years or so - because that's how long it would take - and do so. What we are saying is that there is a need to bring modern technology to the task of species recognition. We also suggest that nature has been kind enough to embed every life form with a 'bar code' and all we need to do is read it."
scrawled on the wall by TheLoneDeRanger : 3/10/2003 10:26:43 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Sony plans to bring the PlayStation 3 video-game console to market this year
Sony plans to bring the PlayStation 3 video-game console to market this year -- a full two years ahead of schedule. This according to sources at the Taiwanese venture that assembles the PlayStation 2 for Sony. The console is expected to feature a revolutionary microprocessor architecture called "cell," which will pack the processing power of a hundred of today's personal computers on a single chip and tap the resources of additional computers using high-speed network connections.
scrawled on the wall by TheLoneDeRanger : 3/10/2003 10:25:55 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Bank glitch gives student $9.9 million
An online banking glitch gave a Princeton University student access to university accounts totaling $9.9 million when he tried to access a student publication's account.
Freshman Ira Leeds didn't take any money.
Leeds, financial manager for The Princeton Tory, was attempting to access the conservative magazine's account with PNC Bank on Friday when he accessed all 15 of the University's accounts, which totaled just over $9.9 million. Cha-Ching!
scrawled on the wall by TheLoneDeRanger : 3/10/2003 10:00:01 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


'03 Weblog Awards
Then there's the Anti-Bloggies.
scrawled on the wall by TheLoneDeRanger : 3/10/2003 09:57:10 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


`Blog' expert sets sights on Harvard: Postings could break barriers
The self-proclaimed ``Pied Piper of Weblogs'' has sold his house in California, loaded his car and is heading east this week to begin a stint at Harvard Law School's Berkman Center for the Internet and Society.
"What I want to do during my fellowship is start a lot of Weblogs in the university, then watch what happens, innovate and try out new ideas,'' said Dave Winer, 47, a California software developer and former contributing editor at Wired magazine. >>
scrawled on the wall by TheLoneDeRanger : 3/10/2003 09:51:29 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Success of Weblogs Heralds Big Future
The online diaries known as Weblogs, or "blogs," seemed like a lot of inconsequential chatter when they surfaced a few years ago.

But as more people have embraced the concept, what once seemed like a passing fancy has morphed into a cutting-edge phenomenon that may provide the platform for the Internet's next wave of innovation and moneymaking opportunities.

"Just like the Internet was 10 years ago, blogging is popular with an underground culture that is doing it for the love and passion," said Tony Perkins, who edited the recently folded Red Herring technology magazine and last month launched a business blog called Always On Network.

"Now there are people like me coming along and trying to figure out how to package it," Perkins said. "It's time to take it to the next level." >>
scrawled on the wall by TheLoneDeRanger : 3/10/2003 09:16:28 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Sony's Idei
In a rare and incredibly candid interview, Nobuyuki Idei, Chairman and CEO of Sony Corporation, tells AlwaysOn what he really thinks.
"The second platform will tie together the PlayStation, the home server, and the TV. We have announced jointly with Panasonic and Philips that we have agreed on the basic Linux kernel for this platform. Based on this Linux kernel, we are developing the middleware and the application interfaces so that our PlayStation, future TVs, and future home video cameras will all work on a single platform." >>
(3 part series. Other parts linked from here.)
scrawled on the wall by TheLoneDeRanger : 3/10/2003 09:10:21 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


The Current Strategic Agenda of the United States
To sum up the following account: The US plans a massive expansionist drive around the world (and indeed even in outer space). In this it plans to take full advantage of its overwhelming military supremacy, including hitherto impermissible means, with inevitably terrible effects on the targeted populations. Not only inconvenient regimes but even certain US client regimes (such as Saudi Arabia) may be targeted. These countries are slated for direct rule by the American military, or rule under close and detailed direction by US monitors—encompassing not only foreign policy and economic policy, but political, social and cultural institutions as well. Direct control of oil will pass into American hands. Importantly, this drive is intended to prevent the emergence of rivals to American worldwide hegemony. >>
scrawled on the wall by TheLoneDeRanger : 3/10/2003 08:39:57 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


TechWeb: Flash Player poses threat
Macromedia Inc. is warning its users of what it calls a critical security flaw found in the latest version of its Flash animation player. It is advising customers to immediately install a new version just released on its Web site which should fix the security hole.

Macromedia says up to 75 percent of computers worldwide run its player.
scrawled on the wall by TheLoneDeRanger : 3/10/2003 08:30:41 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •

sCrAwLz foR Sunday, March 09, 2003
It's Just a Fantasy, but Real Life Is Always in Play (NYT)
It started with The Beast, although no one knew it was The Beast at the time. Some people say it really started with Pink Floyd. Majestic even tried to make money on it but failed. I could tell you what it is, or you could figure it out for yourself. Try some search engines. Ask your friends. Form an online discussion group to trade information. You will know it when you see it.

It is Alternate Reality Gaming, a kind of online game in which clues and puzzles are supplied through Web sites, e-mail messages, phone calls, videos and faxes. Games can send the player to the Web sites of fake organizations or to real Web sites. Discussion groups that try to solve puzzles communally may be joined by people suspected of being the games' designers. >>
scrawled on the wall by TheLoneDeRanger : 3/9/2003 10:25:37 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


More on the Mountain Sub
Mutant sez: "Read the friggin' disclaimer!"
Valis sez: Well, Valis just sez to check it out.

Now there's this page. Be sure to click on the "Now Click Here Link" on the bottom of the page. WTF?
scrawled on the wall by TheLoneDeRanger : 3/9/2003 10:23:37 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Halliburton wins Iraq oil firefighting contract
Big surprise here... Dick Cheney's old Co. wins the contract.. . who would have thought... | Via #!/sablog
scrawled on the wall by TheLoneDeRanger : 3/9/2003 06:23:36 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


www.8march2003.com
You've waited five months.
You've discussed.
You've speculated...
www.8march2003.com

But, you didn't read the Disclaimer... | The Incestuous Linkage of Being
scrawled on the wall by TheLoneDeRanger : 3/9/2003 04:11:20 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


THEORY - PROPAGANDA IN THEORY AND PRACTICE
How Does It Work?
Most people associate propaganda with advertising, with partisan opinion heard on talk shows, or with a zealous Sunday morning radio preacher. Indeed, all of these are forms of propaganda, but for the most part they are the least harmful kind because the audience recognizes them as such. >> | Via abuddhas memes
scrawled on the wall by TheLoneDeRanger : 3/9/2003 04:06:45 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Time Machine by Dr. Vadim A. Chernobrov
Just when you are comfortable you stumble on something that really makes you think. I first stubbled on these ideas of Russian time travel in the wonderful newsletter for the Planetary Association for Clean Energy, Vol.11 Number 4&5 (current). The above link has the same pics, if you have not seen these you will laugh out loud and then get very silent. -Borderland Sciences
scrawled on the wall by TheLoneDeRanger : 3/9/2003 03:34:30 PM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •


Trunk full of books found at Ong's Hat?
Discovered during demolition of an unused area and neglected area of the old Ong's Hat Public Library in the process of transforming it into the new Aglaura Public Library. We were lucky enough to acquire this during the fund raising auction they had and were thrilled to discover stacks of old books and documents inside. We are still going through the contents to assess their value and possible historical significance. We also found the history link on this site to be of particular interest.That's what the website says anyway...
scrawled on the wall by TheLoneDeRanger : 3/9/2003 03:58:57 AM GMT: permalink

• • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • •

MEDIA OF THE MOMENT
Monday, January 05, 2004

Archives | RSS for MoM

Sniff This

Sniffy-pooh

MissTifEye sez: The beguiling quirkiness of Paul Ash's writings and performances come through brilliantly in his website. Paul's zine-style print projects, e-books, & paperbacks feature his own work, including the just-released compendium, "What I Think About When I Go to the Job." Other writers and artists are published on the Sniffy Linings website, an uber-cute experience glued together by dreamy quotes from musicians.

3:57 PM : Permalink

The Book 
Order
Ong's Hat: The Beginning
"I got really into this "time-travel cult" called Ong's Hat when a computer-game programmer I know told me she was contacted by a physics scholar who said that a bunch of her recent games reflected their canon. This dude told my friend that someone from Ong's Hat had befriended her and inspired her to create certain games without her realizing it. Whoa, right?" - Jane Magazine
Buy - Reviews - Free Stuff - MP3 Collections - CTW

Quickclicks
Politics
The HIVE
American Samizdat
Libertythink DataSphere
abuddhas memes
Orlin Grabbe
mousemusings
PNAC Info
WARBLOGGER WATCH
Dave Emory
[older DE archives]
The Rattler
Arts, Sciences & Culture
magdalen sez
2GQ
Association Correlating Non-Essential Research
Meme-§tream 2.3
Society Vertical Portal
Sauceruny
Darkplanet
THE BOOK OF FSCK
Dr. Menlo
Peepshow Stories
Post Atomic
New World Disorder
NWD E-Zine
obscurantist
weblogsky
Techfocus
Cup of Chicha
Thumbmonkey
10,000 Monkeys
Chapel Perilous
Klint's Journal
relicious
God Magazine
Weekly Universe
Aberrant News
Discordian Research Technology
root cellar
YAWN
technoccult
Geisha asobi blog
#!/sablog
technoshamanic
Sensual Liberation Army
Antiquities of The Illuminati
Invisible College
deoxy
Borderland Sciences
Diane di Prima
The Visual Math Institute
Global Consciousness Project
Literary Kicks
Exquisite Corpse
memes.org
Lords of Newark
sassafrass
Anodyne
XAOS
fUSION Anomalog.
Keelynet
Fuckedcompany
William Gibson
Rudy Rucker
Reality Carnival
Newsfeeds-'dexes-Search
Unknown News
News is Free
Popdex
Daypop
Blogdex
memeufacture
ResearchBuzz
KartOO
feedster
coolog
blogoshpere.us
NITLE Blog Census
blizg

myelin: blogging ecosystem

Muse-Eek!
Belief Systems
[Freebies]
Perhaps Transparent
Corporate Collapse
CD Baby
Ong's Hat
Flaming Fire
noiseusse.org
More BLOGage
Among Other Things
wood s lot
eclecticism
Bird on the Moon
Zagula spells trouble
fragments
Wilson's Almanac
six different ways
philosophistry
alex mizell
Dude Home
The Velocity of Roses
yummywakame
noiseusse.org
Space Blog
La Petite Claudine
angilluminati
caitsmeow
Easy Bake Coven
Wizzlopia
Expose This!
Bulletproof Vest
Archetypical
devilducky
omnibuscortex
The Fifth House
The Eye Opener
Pigs in Lipstick
All Consuming
BrainWaves
OnFocus
Mindbleed
thoughts on the eve of the apocalypse
XQ
Two--Four
berfnet
dratfink
The Right Half of My Brain
gregunderwater
BATR
on a darkling plain
charging the canvas
literaturebuzz
Ming the Mechanic
Mirrorshades
Low Grade Panic
Psychicpants
The Obscure Store
Steebstown Massacree
diminishedResponsibility
Psychodyne
Milk and Cookies
< # oddbloggers + >
top-blogs
endmedia
Blogeur
omegapoint
Will's Thrills
consumptive.org
Three Rivers Tech Review
chod's blog
#!/usr/bin/girl
disenchanted
MetaScene
Barbelith
KAAOS
lost in the fog
Weird Files
Future Feed
Hiptop Nation
Plastic Bag
Raise the Fist!
CTheory
BlogWars
Journalista
The Infinite Matrix
Temple of the Screaming Electron
MemeMachineGo!
die puny humans
The Pagan Prattle
the null device
one.point.zero
Schism Matrix
soft skull press
metafilter
FARK
blogcritics
Futurescan
Rushkoff
boing-boing
Viridian
memepool
Alien-UFOs.com
tempus-fugit
the daily phosdex ... your daily online column
The Memory Hole
hacktivismo
Cult of the Dead Cow
Posse
Team sTaRe
(dawgs without collars)
DW, Dr. Menlo, mutant, Valis, Whitey, ozric, Rex , Sinn, monkeyprime, craig, mag/tif, Pagan Moss, NWD, Rupert, Borderlands, Chiaroscuro, metameme, zenpride, EmoryToo, asobi tsuchiya, disadent, motard, antiqillum, Interloper, wink, roberto, S., mediak, humdog, Gabriel, Green, Demitria Monde Thraam, XAOS, atomjack, cyndy, kirsten, relski, Patrick, Kate, beastie, technoccult, newtalk, tate, root.cellar, BBC, FSCK, zedzian, techfocus, sauceruny, Kelley, Todd, play