![]() |
Sign up to receive the sTaRe newsletter! | |||||||||||||||||||||||||||||
| HOME | ARCHIVES | MAKE US YOUR STARTPAGE | RSS | SUGGESTIONS | TEAM | ||||||||||||||||||||||||||||||
|
sCrAwLz foR Saturday, March 15, 2003 A difficult gift As The Three Stigmata Of Palmer Eldritch is reissued, Michael Moorcock finds he has some problems with Philip K Dick The Puma "French Pleasure" Campaign: Hoax It has been brought to our attention that several unauthorized, sexually suggestive advertisements portraying the PUMA brand have been released over the Internet. We are appalled that images like these would be created and distributed under the PUMA name. As a brand, we seek to take a unique perspective toward our advertising in an effort to challenge the boundaries of our industry; however we would never consider using these tactics. We are in the process of researching the circumstances and reserve any legal steps available. Scientists Say Other Universes Physically Real and Inhabited Some of you have asked if we knew where to find this article. Here it is. Hi, I'm Casey Kasem and this is P2P Top 40 Peer-to-peer networks may soon play a prominent role in shaping radio playlists. Clear Channel Communications plans to add data about the popularity of songs on P2P networks to the research services it offers to radio stations. The data, provided by P2P tracking outfit BigChampagne, will provide radio stations with lists of P2P users with MP3 collections similar to their playlists and information about what those people are downloading and offering to other users on the networks. 46th issue of Ten Thousand Monkeys Welcome to the 46th issue of Ten Thousand Monkeys. I'm just gonna cut straight to the chase here, if you don't mind ... This issue is kinda old home week here at M10K. We have some lyrics from our M10K veteran Quintus, and two long lost monkeys are back with some fantabulous stories for your perusal. We also continue our recurring series The Raven, Wounded, and Monterrey Moon, AND a brand new monkey joins the mix with some remixing of his own. Raging Back at the Cow Dr Pepper/Seven Up cowed by Web plan US Announces New Ally: Harvey
The people who control the world Jon Ronson goes looking for 'Them' Parents should be aware of ads posing as games No parent would voluntarily subject a child to 15 minutes of non-stop commercial messages touting candy, junk food or sugar-sweetened cereal. The myth of interference Internet architect David Reed explains how bad science created the broadcast industry. Spooky Story Why the American media shrugged off a story about spying at the United Nations World's first brain prosthesis revealed The world's first brain prosthesis - an artificial hippocampus - is about to be tested in California. Unlike devices like cochlear implants, which merely stimulate brain activity, this silicon chip implant will perform the same processes as the damaged part of the brain it is replacing. PENTAGON THREATENS TO KILL INDEPENDENT REPORTERS IN IRAQ The Pentagon has threatened to fire on the satellite uplink positions of independent journalists in Iraq, according to veteran BBC war correspondent, Kate Adie. In an interview with Irish radio, Ms. Adie said that questioned about the consequences of such potentially fatal actions, a senior Pentagon officer had said: "Who cares.. ..They've been warned." Chinese court date set for Bay Area man GOVERNMENT ACCUSES FALUN GONG FOLLOWER OF DISRUPTING RADIO, TELEVISION BROADCASTS Company to Provide Physics-Based Network Management -- Secures Additional Funding and New Executives Mountain View's Network Physics, a start-up that says it is the first to apply particle physics to network management, announced that it has raised $6 million in funding. The round was led by Sofinnova Venture Partners, and included Vantage Point Venture Partners, Intel Capital, Lucent Venture Partners, InfoVista and AIG German tech fair low-key Thinner and subdued, the world's biggest technology fair reflected the industry mood Tuesday as mobile phone operators unveiled plans to phase in next-generation service and other new gadgets focused on combining or improving existing technology. Anger management attendee arrested for assault in Fremont So much for controlling his temper. A Fremont man has been arrested for allegedly assaulting a 37-year-old acquaintance whom he had recently met at an anger management seminar.David Glen Wilson, 36, had hired the 37-year-old man to install marble at his home on the 5500 block of Truman Place, police said. They began working on the project at 9 p.m. Sunday and continued through the next morning. Iraqi "Smoking gun" made with duct tape A remotely piloted aircraft that the United States has warned could spread chemical weapons appears to be made of balsa wood and duct tape, with two small propellors [sic] attached to what look like the engines of a weed whacker. PAYPAL CLOSES WHAT REALLY HAPPENED ACCOUNT! Just received from PayPal... Vocabulary Lesson of the Day: Catafalque Sure you know that rigor mortis is "rigidity of the muscles which occurs at death," but did you know that algor mortis is "the cooling of the body immediately after death to room temperature and temporary stiffening of the muscles"? You know your morgue from your columbarium, but can you tell your cenotaph from your catafalque? Get it all straight at Funeral Net. (And yes, there is already a Goth band called Catafalque. You can't have the name. Alas.) Official "Extraterrestrial Culture Day" in New Mexico
Benetton clothing to carry tiny tracking transmitters Clothes sold at Benetton stores will soon contain microchip transmitters that allow the Italian retailer to track its garments from their point of manufacture to the moment they're sold in any of its 5,000 shops. Benetton's introduction of "smart tag'' tracking technology will be the largest example of a trend now emerging in the retail industry, according to Phillips Semiconductors, a unit of the Dutch electronics giant that designed 15 million tags being delivered to Benetton this year. Benetton's Sisley line of clothing will contain a Philips Electronics radio frequency ID tag that will replace ubiquitous bar codes, which have to be manually scanned. An RFID tag communicates its location to Benetton's computerized supply chain network, allowing the retailer to learn the status of its inventory at a glance and make restocking decisions quickly -- even automatically, said Terry Phipps, Benetton's electronic data processing director. While there is no indication Benetton intends to track its customers with the tags, privacy advocates are worried that the technology could lend itself to unauthorized customer monitoring. >> House cafeterias change names for 'french fries' and 'french toast' (and you can dance to it...) It's official. Our leaders are idiots...but the real question is...are they WiFries? Does it have a beat? Can I dance to it? Software Pioneer Quits Board of Groove Mitchell D. Kapor, a personal computer industry software pioneer and a civil liberties activist, has resigned from the board of Groove Networks after learning that the company's software was being used by the Pentagon as part of its development of a domestic surveillance system. Three and a half-year old SETI@home project identifies candidate radio signals from space, heads for Arecibo to take second look After more than a million years of computation by more than 4 million computers worldwide, the SETI@home screensaver that crunches data in search of intelligent signals from space has produced a list of candidate radio sources that deserve a second look. Think tanks for gamers Online communities that band together to solve puzzles could provide clues to the next big step in social development. Article on Rupert Sheldrake speech In a new book being published Tuesday, "The Sense of Being Stared At," Sheldrake says 90 percent of people have reported having this sensation. The experience is not a quirk of our brains, he writes, "but leads to the conclusion that our minds are not confined inside our heads." Antiquities of the Illuminati Version 4,4, 11 March 2003 c.e. For whatever it's worth, Version 4.4 is posted. Big fucking sister aside, we have managed to get some material finished. That's an inside joke, for the Initiated, of course. GCHQ arrest over Observer spying report An employee at the top-secret Government Communications Headquarters (GCHQ) has been arrested following revelations in The Observer last weekend about an American 'dirty tricks' surveillance operation to win votes at the United Nations in favour of a tough new resolution on Iraq. Dr. Menlo/NWD E-Zine Review From abuddhas memes Dr. Menlo epitomises the more natural flow of discourse and diversity that is the true strength of the American people. His egalitarian and plainly literate hug embraces such webwonders as American Samizdat, New World Disorder, IncuBlogula, Warblogger Watch, Le Blogeur, thumbmonkey, Sensual Liberation Army, this humble site, and some I'm sure I've missed. Sea-level rise shelved for now Glaciers spotted surging to sea after ice-shelf collapse. Green plans for tiny tech: Nanotechnologists take responsible approach to the environment. A US research centre is working to develop tiny technology in an environmentally friendly way, its director told this week's meeting of the American Physical Society in Austin, Texas. Flashback This impressive Flash movie-trip featuring Albert Hoffman as doc, calls for getting into a certain mindspace, taking the time and enjoying. Exceptional artwork. Don't forget to feed the TACTCTTTACCTTTTATTCG This past weekend 40 scientists determined to describe and name the estimated 10 million animal species that have not yet been catalogued met to discuss an alternative to the official Latin monikers used to classify the world's animal species: bar codes. "The proper naming of species has become a serious bottleneck," said Professor Paul Hebert, of the University of Guelph, in Canada, who attended the meeting. "I do think it is a serious problem, and I believe the move to DNA-based taxonomy will lead to a new approach to the description of species. After the bar coding, those who then want to name and describe species can come along over the next 2,000 years or so - because that's how long it would take - and do so. What we are saying is that there is a need to bring modern technology to the task of species recognition. We also suggest that nature has been kind enough to embed every life form with a 'bar code' and all we need to do is read it." Sony plans to bring the PlayStation 3 video-game console to market this year Sony plans to bring the PlayStation 3 video-game console to market this year -- a full two years ahead of schedule. This according to sources at the Taiwanese venture that assembles the PlayStation 2 for Sony. The console is expected to feature a revolutionary microprocessor architecture called "cell," which will pack the processing power of a hundred of today's personal computers on a single chip and tap the resources of additional computers using high-speed network connections. Bank glitch gives student $9.9 million An online banking glitch gave a Princeton University student access to university accounts totaling $9.9 million when he tried to access a student publication's account. '03 Weblog Awards Then there's the Anti-Bloggies. `Blog' expert sets sights on Harvard: Postings could break barriers The self-proclaimed ``Pied Piper of Weblogs'' has sold his house in California, loaded his car and is heading east this week to begin a stint at Harvard Law School's Berkman Center for the Internet and Society. Success of Weblogs Heralds Big Future The online diaries known as Weblogs, or "blogs," seemed like a lot of inconsequential chatter when they surfaced a few years ago. Sony's Idei In a rare and incredibly candid interview, Nobuyuki Idei, Chairman and CEO of Sony Corporation, tells AlwaysOn what he really thinks. The Current Strategic Agenda of the United States To sum up the following account: The US plans a massive expansionist drive around the world (and indeed even in outer space). In this it plans to take full advantage of its overwhelming military supremacy, including hitherto impermissible means, with inevitably terrible effects on the targeted populations. Not only inconvenient regimes but even certain US client regimes (such as Saudi Arabia) may be targeted. These countries are slated for direct rule by the American military, or rule under close and detailed direction by US monitors—encompassing not only foreign policy and economic policy, but political, social and cultural institutions as well. Direct control of oil will pass into American hands. Importantly, this drive is intended to prevent the emergence of rivals to American worldwide hegemony. >> TechWeb: Flash Player poses threat Macromedia Inc. is warning its users of what it calls a critical security flaw found in the latest version of its Flash animation player. It is advising customers to immediately install a new version just released on its Web site which should fix the security hole. It's Just a Fantasy, but Real Life Is Always in Play (NYT) It started with The Beast, although no one knew it was The Beast at the time. Some people say it really started with Pink Floyd. Majestic even tried to make money on it but failed. I could tell you what it is, or you could figure it out for yourself. Try some search engines. Ask your friends. Form an online discussion group to trade information. You will know it when you see it. More on the Mountain Sub Mutant sez: "Read the friggin' disclaimer!" Halliburton wins Iraq oil firefighting contract Big surprise here... Dick Cheney's old Co. wins the contract.. . who would have thought... | www.8march2003.com You've waited five months. THEORY - PROPAGANDA IN THEORY AND PRACTICE How Does It Work? Time Machine by Dr. Vadim A. Chernobrov Just when you are comfortable you stumble on something that really makes you think. I first stubbled on these ideas of Russian time travel in the wonderful newsletter for the Planetary Association for Clean Energy, Vol.11 Number 4&5 (current). The above link has the same pics, if you have not seen these you will laugh out loud and then get very silent. - Trunk full of books found at Ong's Hat? Discovered during demolition of an unused area and neglected area of the old Ong's Hat Public Library in the process of transforming it into the new Aglaura Public Library. We were lucky enough to acquire this during the fund raising auction they had and were thrilled to discover stacks of old books and documents inside. We are still going through the contents to assess their value and possible historical significance. We also found the history link on this site to be of particular interest. |
| ||||||||||||||||||||||||||||